Sequencing Primers

InvivoGen Kontakt z doradcą
Sequencing Primers

Open Reading Frame Vector Sequencing Primers

pUNO / pUNO1 / pUNO2 / pUNO3 / pSelect

5' primer

  • TGCTTGCTCAACTCTACGTC
  • Forward
  • HTLV 5'UTR

3' primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

Cloning Vector Sequencing Primers

pCpGfree

5' primer

  • GCAGGAAAAGTGGCACTGTG
  • Forward
  • EF1 5'UTR

3' primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

pCpGfree-basic

5' primer

  • TACCAGTTTTATTGTTTTTAGTGGTAGTG
  • Forward
  • ßGlobin MAR

3' primer

  • CATGGTGGAAGCTACTGTACAC
  • Reverse
  • UTR5'

pCpGfree-promoter

5' primer

  • GTACCAGTTTTATTGTTTTTAGTGGTAGTG
  • Forward
  • ßGlobin MAR

3' primer

  • GCCATGTGCTCTCTGCCCACTGAG
  • Reverse
  • EF1 prom

pCpGfree-vitro

5' primer

  • GTGCAGTAGTCTCTGTGAACATTCAAGC
  • Forward
  • EF1 prom

3' primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

pCpGrich

5' primer

  • GCAGGAAAAGTGGCACTATG
  • Forward
  • EF1 5'UTR

3' primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

pFUSE-CLIg / pFUSE-CHIg

5' primer

  • TGCTTGCTCAACTCTACGTC
  • Forward
  • HTLV 5'UTR

pFUSE-Fc / pINFUSE (human IgG1, IgG2, IgG3, IgG4 and rabbit IgG)

5' primer

  • TGCTTGCTCAACTCTACGTC
  • Forward
  • HTLV 5'UTR

3' primer

  • CTCACGTCCACCACCACGCA
  • Reverse
  • Fc

pFUSE-Fc (mouse IgG1)

5' primer

  • TGCTTGCTCAACTCTACGTC
  • Forward
  • HTLV 5'UTR

3' primer

  • GTGAGCACATCCTTGGGCTT
  • Reverse
  • Fc

pFUSE-Fc / pINFUSE (mouse IgG2a, IgG2b, IgG3)

5' primer

  • TGCTTGCTCAACTCTACGTC
  • Forward
  • HTLV 5'UTR

3' primer

  • GGAAGATGAAGACGGATGGTC
  • Reverse
  • Fc

pFUSE-Fc (rat IgG1)

5' primer

  • TGCTTGCTCAACTCTACGTC
  • Forward
  • HTLV 5'UTR

3' primer

  • TGGGAGATCAAGAGGATGTC
  • Reverse
  • Fc

pFUSEN

3' primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

pTRIOZ

Light chain, 5’ primer

  • TTGCCTCATTCTCAAGCCTCAGAC
  • Forward
  • chEF1 5'UTR

Light chain, 3’ primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

Heavy chain, 5’ primer

  • GGGGGAGGGGATGTAATGGCGTTG
  • Forward
  • mEF1 5'UTR

Heavy chain, 3’ primer

  • TTAGGCAGAATCCAGATGCTC
  • Reverse
  • hßGlobin pAn

pVAC1

5' primer

  • TGTATAGGATGCAACTGCTG
  • Forward
  • IL2ss

3' primer

  • GAAACAAACAGTTCTGAGACCG
  • Reverse
  • EF1 pAn

pVAC2

5' primer

  • TCTCAAGCTTCAGACAGTG
  • Forward
  • rhEF1 5'UTR

3' primer

  • GAAACAAACAGTTCTGAGACCG
  • Reverse
  • EF1 pAn

pVITRO1

5' primer

  • GAGGCTAATTCTCAAGCCTC
  • MCS1 Forward
  • rEF1 5'UTR

3' primer

  • TCTAGACCTGGAAAGACCAG
  • MCS1 Reverse
  • FMDV IRES

5' primer

  • TTTTGAGCGGAGCTAATTCTCGGG
  • MCS2 Forward
  • mEF1 5'UTR

3' primer

  • AAAAAACCTCCCACACCTCC
  • MCS2 Reverse
  • SV40 pAn

pVITRO2 / pDUO2

5' primer

  • TTTTGAGCGGAGCTAATTCTCGGG
  • MCS1 Forward
  • mEF1 5'UTR

3' primer

  • TCTAGACCTGGAAAGACCAG
  • MCS1 Reverse
  • FMDV IRES

5' primer

  • TTGCCTCATTCTCAAGCCTCAGAC
  • MCS2 Forward
  • chEF1 5'UTR

3' primer

  • GCATTCTAGTTGTGGTTTGTCC
  • MCS2 Reverse
  • SV40 pAn

pVIVO1

5' primer

  • GCGCGGCTGGAGGTGTGAGG
  • MCS1 Forward
  • hGRP94 prom

3' primer

  • GAAACAAACAGTTCTGAGACC
  • MCS1 Reverse
  • EF1 pAn

5' primer

  • CTCCTGTCGCCCTCAGATCG
  • MCS2 Forward
  • hGRP78 prom

3' primer

  • AAAAAACCTCCCACACCTCC
  • MCS2 Reverse
  • SV40 pAn

pVIVO2

5' primer

  • TTTTGAGCGGAGCTAATTCTCGGG
  • MCS1 Forward
  • mEF1 5'UTR

3' primer

  • GAAACAAACAGTTCTGAGACCG
  • MCS1 Reverse
  • EF1 pAn

5' primer

  • TTGCCTCATTCTCAAGCCTCAGAC
  • MCS2 Forward
  • chEF1 5'UTR

3' primer

  • GCATTCTAGTTGTGGTTTGTCC
  • MCS2 Reverse
  • SV40 pAn

pMONO

5' primer

  • TTTTGAGCGGAGCTAATTCTCGGG
  • MCS Forward
  • mEF1 5'UTR

3' primer

  • TCTAGACCTGGAAAGACCAG
  • MCS Reverse
  • FMDV IRES 

Discontinued vectors

pBLAST42 / pBLAST49 / pORF / pORF9

5' primer

  • TGCTTGCTCAACTCTACGTC
  • Forward
  • HTLV 5'UTR

3' primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

pBLAST45 / pORF5

5' primer

  • AGCTTTCTTTCCCCAGATCC
  • Forward
  • eiF4g 5'UTR

3' primer

  • AACTTGTTTATTGCAGCTT
  • Reverse
  • SV40 pAn

Podobne produkty

pWHERE

pWHERE

InvivoGen
Więcej
Selective Antibiotics

Selective Antibiotics

InvivoGen
Więcej
pBROAD3

pBROAD3

InvivoGen
Więcej